View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_low_20 (Length: 305)
Name: NF2356_low_20
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 21 - 268
Target Start/End: Original strand, 28240958 - 28241205
Alignment:
| Q |
21 |
gtggaggcattgctagagtctagagatgcaaatggttgtttcctctattcaagcagaactctgggttattgcttgctgtcagtgtcattaacaattgatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28240958 |
gtggaggcattgctagagtctagagatgcaaatggttgtttcctctattcaagcagaactctgggttattgcttgctgtcagtgtcattaacaattgatg |
28241057 |
T |
|
| Q |
121 |
tgttcagtcccacgattgatttgggattgttcaaagaattgaagagaggacaaaaagttttgatacctctcatattaactatgttcttagagaggctgac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28241058 |
tgttcagtcccacgattgatttgggattgttcaaagaattgaagagaggacaaaaagttctgatacctctcatattaactatgttcttagagaggctgac |
28241157 |
T |
|
| Q |
221 |
gaaattgcagatagtcttgcaaagtttggcctttctctaacttgtaga |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28241158 |
gaaattgcagatagtcttgcaaagtttggcctttctctaacttgtaga |
28241205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University