View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2356_low_20 (Length: 305)

Name: NF2356_low_20
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2356_low_20
NF2356_low_20
[»] chr1 (1 HSPs)
chr1 (21-268)||(28240958-28241205)


Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 21 - 268
Target Start/End: Original strand, 28240958 - 28241205
Alignment:
21 gtggaggcattgctagagtctagagatgcaaatggttgtttcctctattcaagcagaactctgggttattgcttgctgtcagtgtcattaacaattgatg 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28240958 gtggaggcattgctagagtctagagatgcaaatggttgtttcctctattcaagcagaactctgggttattgcttgctgtcagtgtcattaacaattgatg 28241057  T
121 tgttcagtcccacgattgatttgggattgttcaaagaattgaagagaggacaaaaagttttgatacctctcatattaactatgttcttagagaggctgac 220  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
28241058 tgttcagtcccacgattgatttgggattgttcaaagaattgaagagaggacaaaaagttctgatacctctcatattaactatgttcttagagaggctgac 28241157  T
221 gaaattgcagatagtcttgcaaagtttggcctttctctaacttgtaga 268  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
28241158 gaaattgcagatagtcttgcaaagtttggcctttctctaacttgtaga 28241205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University