View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_low_22 (Length: 290)
Name: NF2356_low_22
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 217; Significance: 1e-119; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 21 - 273
Target Start/End: Complemental strand, 27837208 - 27836956
Alignment:
| Q |
21 |
gtgtccataacacttctctcttaactattgataaatggattcgtagttgatattatatgcacatgcataacaaatcgttagtataatgaaacattattta |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27837208 |
gtgttcataacacttctctcttaactattgataaatggattcgtagttgatattatatgcacatgcataacaaatcgttagtataatgaaacattattta |
27837109 |
T |
|
| Q |
121 |
tatttggttttttcactttactcgatttactttagaggaggcaaatcaaaattttcctnnnnnnnntaaattaacaatgtaaatgacttatttgctttaa |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27837108 |
tatttggttttttcactttactcgatttactttagaggaggcaaatcaaaattttcctaaaaaaaataaattaacagtgtaaatgacttatttgctttaa |
27837009 |
T |
|
| Q |
221 |
ggcaaataatatagtaaattttgcaagttgcatatggtattggtatatggtat |
273 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27837008 |
ggtaaataatatagtaaattttgcaagttgcatatggtattggtatatggtat |
27836956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 64 - 98
Target Start/End: Complemental strand, 35257365 - 35257331
Alignment:
| Q |
64 |
tagttgatattatatgcacatgcataacaaatcgt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35257365 |
tagttgatattatatgcacatgcataacaaatcgt |
35257331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 95
Target Start/End: Complemental strand, 42731683 - 42731654
Alignment:
| Q |
66 |
gttgatattatatgcacatgcataacaaat |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42731683 |
gttgatattatatgcacatgcataacaaat |
42731654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 66 - 96
Target Start/End: Complemental strand, 1550480 - 1550450
Alignment:
| Q |
66 |
gttgatattatatgcacatgcataacaaatc |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
1550480 |
gttgatattatatgcacatgcataacaaatc |
1550450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 64 - 98
Target Start/End: Original strand, 15252198 - 15252232
Alignment:
| Q |
64 |
tagttgatattatatgcacatgcataacaaatcgt |
98 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
15252198 |
tagttgatattatatggacatgcataacaaatcgt |
15252232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University