View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_low_23 (Length: 283)
Name: NF2356_low_23
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_low_23 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 64 - 259
Target Start/End: Complemental strand, 34772023 - 34771828
Alignment:
| Q |
64 |
gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34772023 |
gctacttcatcaccagcttccctctcttcttgctgccatgacttttttggcttttcatgattttctttgcaagacaagcaccatccatcattataattgc |
34771924 |
T |
 |
| Q |
164 |
acaagcaggtcatctcatgtctttccctttcataagctgaaacaaaataagattaacaaaattataactcataacaaccaaccatcccagattctc |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34771923 |
acaagcaggtcatctcatgtctttccctttcataagctgaaacaaaataagattaacaaaattataactcataacaaccaaccatcccagattctc |
34771828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University