View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_low_28 (Length: 266)
Name: NF2356_low_28
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_low_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 43805479 - 43805223
Alignment:
| Q |
1 |
acggaggaacaaggtgatggcggagagaatgaagatgagtgtgaaaatgagaaacaggggaagggatgaaagaaacatgttttcgatgaaaatgaggctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805479 |
acggaggaacaaggtgatggcggagagaatgaagatgagtgtgaaaatgagaaacaggggaagggatgaaagaaacatgttttcgatgaaaatgaggctg |
43805380 |
T |
|
| Q |
101 |
cttctgatttttcataagcaaagtggtggtagataagatgaaaagaagttttgataacattttaataattggttgacaacttcaagcccccagttagtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805379 |
cttctgatttttcataagcaaagtggtggtagataagatgaaaagaagttttgataacattttaataattggttgacaacttcaagcccccagttagtct |
43805280 |
T |
|
| Q |
201 |
ttaccagaaccgttcaaaagcagccactgtttctccattttttgccattagtataat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43805279 |
ttaccagaaccgttcaaaagcagccactgtttctccattttttgccattagtataat |
43805223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University