View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_low_29 (Length: 259)
Name: NF2356_low_29
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_low_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 15 - 241
Target Start/End: Complemental strand, 31870458 - 31870232
Alignment:
| Q |
15 |
cagagaaggccaagaagaaaggggaagctttagatggttcattggcgatggagatatcgccggcggatttggataatgtgaaggagaagaaggaattgat |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870458 |
cagagaaggccaagaagaaaggggaagctttagatggttcattggcgatggagatatcgcccgcggatttggataatgtgaaggagaagaaggaattgat |
31870359 |
T |
 |
| Q |
115 |
ggaggagagatgtgctgcttattggactacattggctcctaatgtggaggattatagtggaaccgcggcgaagctgatcgcggccggttctggtcaattg |
214 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31870358 |
ggaggagagatgtgctgcctattggactacattggctcctaatgtggaggattatagtggaaccgcggcgaagctgatcgcggccggttctggtcaattg |
31870259 |
T |
 |
| Q |
215 |
gttaaagggattttgtggtgtggggat |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31870258 |
gttaaagggattttgtggtgtggggat |
31870232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 94 - 174
Target Start/End: Original strand, 8851494 - 8851574
Alignment:
| Q |
94 |
gaaggagaagaaggaattgatggaggagagatgtgctgcttattggactacattggctcctaatgtggaggattatagtgg |
174 |
Q |
| |
|
|||| |||||||||| ||||||||| | |||||| || ||||||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
8851494 |
gaagaagaagaaggagatgatggaggggcaatgtgcggcgtattggactacattggcaccgaatgtggaggagtatagtgg |
8851574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 27878466 - 27878417
Alignment:
| Q |
127 |
tgctgcttattggactacattggctcctaatgtggaggattatagtggaa |
176 |
Q |
| |
|
||||||||||||||| || ||||| || || ||||||||||||||||||| |
|
|
| T |
27878466 |
tgctgcttattggacaacgttggcaccaaacgtggaggattatagtggaa |
27878417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University