View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_low_32 (Length: 238)
Name: NF2356_low_32
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 23 - 170
Target Start/End: Original strand, 45314035 - 45314168
Alignment:
| Q |
23 |
aggatgacgggagggatgaactggtgatggtggtggaggttgttgttgttgcagttgcacggtgaagtgaggaacggtgttggcaagttcttgttgggaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
45314035 |
aggatgacgggagggatgaactggtgatggtggtggaggttgttgttgttgcagttgcacggtgaagtgagtaacgg--------------tgttgggaa |
45314120 |
T |
|
| Q |
123 |
gttgatatacgaatggatcttcttcgctgctaccaccttccatattcg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45314121 |
gttgatatacgaatggatcttcttcgctgctaccaccttccatattcg |
45314168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 188 - 231
Target Start/End: Original strand, 45314189 - 45314232
Alignment:
| Q |
188 |
agaagaataagaataacttacccaatcctcttttttactttcat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45314189 |
agaagaataagaataacttacccaatcctcttttttactttcat |
45314232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 52 - 93
Target Start/End: Complemental strand, 54631224 - 54631183
Alignment:
| Q |
52 |
gtggtggaggttgttgttgttgcagttgcacggtgaagtgag |
93 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
54631224 |
gtggtggtggttgttgttgttgcagttgcagggtgaagtgag |
54631183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University