View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2356_low_34 (Length: 234)

Name: NF2356_low_34
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2356_low_34
NF2356_low_34
[»] chr3 (1 HSPs)
chr3 (1-210)||(39078060-39078269)


Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 210
Target Start/End: Complemental strand, 39078269 - 39078060
Alignment:
1 ttacaacttgatagattgcttgaataggtgaatgagttgaataacacttcgtcgtcttagaggtggagtaattgcctccaaacacttcaaagctaaaatc 100  Q
    ||||||||||| | |||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39078269 ttacaacttgaaaaattgcttgaataggtgaacgagttgaaaaacacttcgtcgtcttagaggtggagtaattgcctccaaacacttcaaagctaaaatc 39078170  T
101 aatatgagaatgcaatagaaattgtgtacctttcactgggactgtccttagtcattaggacgatctcgtgttggatcccccaccttctatcattgaaaca 200  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||    
39078169 aatatgagaatgcaataaaaattgtgtacctttcactgggactgtccttagttattaagacgatctcgtgttggatcccccaccttctatcattgaaaca 39078070  T
201 atctatctta 210  Q
    ||||||||||    
39078069 atctatctta 39078060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University