View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2356_low_36 (Length: 214)
Name: NF2356_low_36
Description: NF2356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2356_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 18 - 199
Target Start/End: Original strand, 37181960 - 37182141
Alignment:
| Q |
18 |
ttttctacttaccagtttggtactattgcttgtacttttgaatttaatttattgatgttgaatacacatacacttttatatacaattatgatgaattctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37181960 |
ttttctacttaccagtttggtactattgcttgtacttttgaatttaatttattgatgttgaatacacatacacatttatatacaattatgatgaattctt |
37182059 |
T |
 |
| Q |
118 |
tcttgtttatgaccactatatatcataaaggatagactaaacttaataatttgcggtccaataacaaacagattcgcctatg |
199 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37182060 |
tcttgtttatgaccactatatctcataaaggatagactaaacttaataatttgcggtccaataacaaacagattcgcctatg |
37182141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 37187455 - 37187393
Alignment:
| Q |
19 |
tttctacttaccagtttggtactattgcttgtacttttgaatttaat-ttattgatgttgaat |
80 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||||| || ||||||||||||||| |
|
|
| T |
37187455 |
tttctacttaccagtttggcactattgcttgtactattgaattttatattattgatgttgaat |
37187393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 37203948 - 37203887
Alignment:
| Q |
19 |
tttctacttaccagtttggtactattgcttgtacttttgaatttaatttattgatgttgaat |
80 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
37203948 |
tttctacttgccagtttggcactatttcttgtacttttgaatttatattattgatgttgaat |
37203887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 37190075 - 37190133
Alignment:
| Q |
18 |
ttttctacttaccagtttggtactattgcttgtacttttgaatttaatttattgatgtt |
76 |
Q |
| |
|
||||||||||||| |||||| ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
37190075 |
ttttctacttacctgtttggcactattgtttgtacttttgaatttctgttattgatgtt |
37190133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 43 - 80
Target Start/End: Complemental strand, 38704013 - 38703976
Alignment:
| Q |
43 |
ttgcttgtacttttgaatttaatttattgatgttgaat |
80 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38704013 |
ttgcttgtacttttgaatttatattattgatgttgaat |
38703976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University