View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2357_high_13 (Length: 340)
Name: NF2357_high_13
Description: NF2357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2357_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 18 - 332
Target Start/End: Original strand, 33183253 - 33183567
Alignment:
| Q |
18 |
gatatttcaatggagtacacaaatcaatgccaattccccttacagaaagcttcacaccagattcaatctgtccaaaaatcacttcttcatcttctacatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183253 |
gatatttcaatggagtacacaaatcaatgccaattccccttacagaaagcttcacaccagattcaatctgtccaaaaatcacttcttcatcttctacatc |
33183352 |
T |
 |
| Q |
118 |
catcaattctttgatatctgtcactatgagtctttcagctatgcaatatgtgtcccttaatgcagcctcagcagtttgctttaagtctctaactgttgca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183353 |
catcaattctttgatatctgtcactatgagtctttcagctatgcaatatgtgtcccttaatgcagcctcagcagtttgctttaagtctctaactgttgca |
33183452 |
T |
 |
| Q |
218 |
tgcaatggaacagttacaatctcaccacaagatggcccttttaaatcagacttattctcaacgaaattcggtttcaaatggcaaataaatgtcaaaactt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183453 |
tgcaatggaacagttacaatctcaccacaagatggcccttttaaatcagacttattctcaacgaaattcggtttcaaatggcaaataaatgtcaaaactt |
33183552 |
T |
 |
| Q |
318 |
gttccatttcatctc |
332 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33183553 |
gttccatttcatctc |
33183567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University