View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2357_high_26 (Length: 251)
Name: NF2357_high_26
Description: NF2357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2357_high_26 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 13 - 251
Target Start/End: Original strand, 47101494 - 47101730
Alignment:
| Q |
13 |
aaaattaccaagaaaaactatatatttgtctataattctatccctaagtgctagggatcaatttccattcttttctcacttggatcctctagggttaggt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47101494 |
aaaattaccaagaaaaactatatatttgtctataattctatccctaagtgctagggatcaatttccattcttttc--acttggatcctctagggttaggt |
47101591 |
T |
 |
| Q |
113 |
tttaccttgcaacaagccgttcgattaatggatctctcttattataatgacatatacaaatagctatcatgccgccacaccatgaaagcacaccgtagag |
212 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47101592 |
tttaccttgcaacaagccgttagattaatggatctctcttaatataatgacatatacaaatagctatcatgccgccacaccatgaaagcacaccatagag |
47101691 |
T |
 |
| Q |
213 |
ggtccattgaaggactatattatatatgtgcacatcatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47101692 |
ggtccattgaaggactatattatatatgtgcacatcatt |
47101730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University