View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2357_high_38 (Length: 222)
Name: NF2357_high_38
Description: NF2357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2357_high_38 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 212
Target Start/End: Original strand, 29163497 - 29163691
Alignment:
| Q |
18 |
ctgaggacatgctgcattaattgaaccataaactttcaccaccatatttcccctgctctttaattacttgaaaatgccctaaaatctcagtgatgataat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29163497 |
ctgaggacatgctgcattaattgaaccataaactttcaccaccatatttcccctgctctttaattacttgaaaataccctaaaatctcagtgatgataat |
29163596 |
T |
 |
| Q |
118 |
tataatgttgatatgcatatgatatcttgatttgggtgtcgaatatatatatagcatcaacaacaagtgcatgttttctcatttaattttcttgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29163597 |
tataatgttgatatgcatatgatatcttgatttgggtgtcgaatatatatatagcatcaacaacaagtgcatgttttctcatttaatttttttgg |
29163691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University