View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2357_high_39 (Length: 220)
Name: NF2357_high_39
Description: NF2357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2357_high_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 202
Target Start/End: Complemental strand, 41063274 - 41063089
Alignment:
| Q |
17 |
agagaagagtgatgtgtacagctatggtgttgtgctccttgagatgttaactggaatggaaccaactgataacaggattccagagggtgctcacattgta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41063274 |
agagaagagtgatgtgtacagctatggtgttgtgctccttgagatgttaactggaatggaaccaactgataacaggattccagagggtgctcacattgta |
41063175 |
T |
 |
| Q |
117 |
acatgggttatcagcgaaatcagagagaagaaaaaagaattcacatctattattgatcagcaattattattacagtgtggaacaaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41063174 |
acatgggttatcagcgaaatcagagagaagaaaaaagaattcacatctattattgatcagcaattattattacagtgtggaacaaa |
41063089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University