View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2357_low_27 (Length: 251)
Name: NF2357_low_27
Description: NF2357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2357_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 25716623 - 25716377
Alignment:
| Q |
1 |
caaagattatcgttaacgtggtgccatagcatatgctttttagttaacactttataagagcactacacaacaaacacaaattgcacnnnnnnnnnnnnnn |
100 |
Q |
| |
|
|||||||||||| ||||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25716623 |
caaagattatcgataacgtggtgccacaccatttgctttttagttaacactttataagagcactacacaacaaacacaaattgcactttttttcctttta |
25716524 |
T |
|
| Q |
101 |
aacaaaacaagacagaacccaaatttgaacttttccaaacaacctagaaccactaaatgtcaattaaaaaatgattcaattttgaaagaataaagtcaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25716523 |
aacaaaacaagacagaacccaaatttgaacttttccaaacaaccaagaaccactaaacgtcaattaaaaaatgattcaattttgaaagaataaagtcaaa |
25716424 |
T |
|
| Q |
201 |
acctaactatagactcaaaactcacctctctttttcctatgcttctc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25716423 |
acctaactatagactcaaaactcacctctctttttcctatgcttctc |
25716377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University