View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2357_low_37 (Length: 239)
Name: NF2357_low_37
Description: NF2357
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2357_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 91 - 189
Target Start/End: Original strand, 47157076 - 47157174
Alignment:
| Q |
91 |
ttaaaatgaatgaatgctgacggttacaattgggctctcgacttgtttgtttagtttcataaccctcaattcaattattatcatatgttacttgttaat |
189 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47157076 |
ttaaaatgaatgaatgttgacagttacaattgggctctcgacttgtttgtttagtttcataaccctcaattcaattattatcatatgttacttgttaat |
47157174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 47156923 - 47157007
Alignment:
| Q |
1 |
ttttgttttgtttagattgggtttagtaaccagggtaaagttgacgtttaaatttgatcatctgtttaaattatgtttcaattac |
85 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47156923 |
ttttgttttgttttgattgggtttagtaacaagggtaaagttgacgtttaaatttgatcatctgtttaaattatgtttcaattac |
47157007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University