View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2360_high_4 (Length: 242)
Name: NF2360_high_4
Description: NF2360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2360_high_4 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 5 - 242
Target Start/End: Complemental strand, 43608802 - 43608565
Alignment:
| Q |
5 |
atgaagggattttgtcacctgtcggtccccgtgaaaggctcttaaggagattgctttcttggattggacttattccgcctacaccagaaccaccttttca |
104 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43608802 |
atgaagggattttgtcacctgtaggtccccgtgaaaggctcttaaggagattgctttcttggattggacttattccgcctacaccagaaccaccttttca |
43608703 |
T |
 |
| Q |
105 |
ggttgaaaatgatggtgactctcctgaaccttatctaaggtttgctccacaaacagctcttttattactgtctgttaactctcttagaagctcctattat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43608702 |
ggttgaaaatgatggtgactctcctgaaccttatctaaggtttgctccacaaacagctcttttattacagtctgttaactctcttagaagctcctattat |
43608603 |
T |
 |
| Q |
205 |
ttgaatgataaatgaactactgtttgctttccgtcatt |
242 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
43608602 |
ttgaatgataaaggaactaatgtttgctttccgtcatt |
43608565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University