View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2360_low_1 (Length: 273)
Name: NF2360_low_1
Description: NF2360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2360_low_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 1926355 - 1926601
Alignment:
| Q |
1 |
gataatgttgttcctgatgatgttttttggtgggatggtttgggtgatgatcaaggagtttcttgcagtcaacaacaagaggatttgaacatttccattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1926355 |
gataatgttgttcctgatgatgttttttggtgggatggtttgggtgatgatcaaggagtttcttgcagtcaacaacaagaggatttgaacatttccattg |
1926454 |
T |
|
| Q |
101 |
aagactatctataatttacaacactcacacaccctgcgcatgtgttaaaatgtggtggtatattatttttagatttagatgtatactttagtggtttaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1926455 |
aagactatctataatttacaacactcacacaccctgcgcatgtgttaaaatgtggtggtatattatgtttagatttagatgtatactttagtggtttaca |
1926554 |
T |
|
| Q |
201 |
agttacaacaagtggttagtgtttttgtgtggaaatgtaatcaagaaaaatgaag |
255 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
1926555 |
agttacaacaagtggttagtgtt--------gaaatgtaatcaagaaaaatgaag |
1926601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University