View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2360_low_2 (Length: 252)
Name: NF2360_low_2
Description: NF2360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2360_low_2 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 33816215 - 33816001
Alignment:
| Q |
1 |
taattgtagcaaactaa---atgttatttaactcatcgcgtataagctcgtataatcaaaattgagttctttggtaaccatattctctcatgaacttata |
97 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33816215 |
taattgtagcaaactaacaaatgttatttaactcatcgcgtataagctcgtataatcaaaatagagttgtttggtaaccatattctctcatgaacttata |
33816116 |
T |
|
| Q |
98 |
acattttttcactagcttatagcttaatgctacttcaaacaacatttaatcttttaacttatagcacattgttttttccctcattattttaattgaaaaa |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33816115 |
acattttttcactagcttatagcgtaatgctacttcaaacaacatttgatcttttaacttatagcacattgttttttccctcattattttaattgaaaaa |
33816016 |
T |
|
| Q |
198 |
ggtcaaatgttaatt |
212 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
33816015 |
gatcaaatgttaatt |
33816001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University