View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2361_low_15 (Length: 263)
Name: NF2361_low_15
Description: NF2361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2361_low_15 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 130 - 263
Target Start/End: Complemental strand, 33376864 - 33376718
Alignment:
| Q |
130 |
gattattgtttgttgttttctaccagtgctttctctatcctttatttgttttctattgacttgatttttatgatgtctatctttgtccatcaacatgttg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33376864 |
gattattgtttgttgttttctaccagtgctttctctatcctttatttgttttctattgacttgatttttatgatgtctatctttgtccatcaacatgttg |
33376765 |
T |
|
| Q |
230 |
-------------ttctcttaattagttaaaaagaactaccgcataa |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33376764 |
tgctatataacacttctcttaattagttaaaaagaactaccgcataa |
33376718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 227
Target Start/End: Complemental strand, 3339634 - 3339532
Alignment:
| Q |
127 |
ttggattattgtttgttgttttctaccagtgctttctctatccttta--tttgttttctattgacttgatttttatgatgtctatctttgtccatcaaca |
224 |
Q |
| |
|
|||||| ||||||||||||||| ||||| || ||||||| | ||| ||| |||||||||| |||||||||| | |||||||||| ||||||||||| |
|
|
| T |
3339634 |
ttggatgattgtttgttgttttataccattgttttctctccgccttattttttttttctattggcttgatttttgagttgtctatcttcgtccatcaaca |
3339535 |
T |
|
| Q |
225 |
tgt |
227 |
Q |
| |
|
||| |
|
|
| T |
3339534 |
tgt |
3339532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University