View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2361_low_16 (Length: 255)
Name: NF2361_low_16
Description: NF2361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2361_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 95 - 251
Target Start/End: Original strand, 33384887 - 33385043
Alignment:
| Q |
95 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33384887 |
attttcccattgtatgcagctggattattgacttcatttctgttgaagttgaaaaatgatggatttcaacatgattcatcttgggagaacatgaaatctt |
33384986 |
T |
 |
| Q |
195 |
atggcggttttgtactggatgggnnnnnnnngccaccagtaattctaaacttgtttt |
251 |
Q |
| |
|
|||||||||| ||| ||||||| ||||| |||||||||||||||||||| |
|
|
| T |
33384987 |
atggcggtttggtattggatggctttcttgtgccacaagtaattctaaacttgtttt |
33385043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University