View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2361_low_4 (Length: 361)

Name: NF2361_low_4
Description: NF2361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2361_low_4
NF2361_low_4
[»] chr5 (1 HSPs)
chr5 (1-95)||(6580199-6580293)
[»] chr2 (1 HSPs)
chr2 (298-345)||(2251530-2251577)


Alignment Details
Target: chr5 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 6580293 - 6580199
Alignment:
1 tcatcagccttcttgataaagtgttcggaaagtcctgggctagaaactacacttcaacaacattatgcagatcaatatagttattacctttaaat 95  Q
    ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6580293 tcatcagtcttcttgacaaagtgttcggaaagtcctgggctagaaactacacttcaacaacattatgcagatcaatatagttattacctttaaat 6580199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 298 - 345
Target Start/End: Complemental strand, 2251577 - 2251530
Alignment:
298 aaaagtaaagtagagataaatatatgagatattccttctcttctctcc 345  Q
    |||| ||||||||||||||||||||||||||| |||||||||||||||    
2251577 aaaaataaagtagagataaatatatgagatatcccttctcttctctcc 2251530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University