View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2363_high_12 (Length: 316)
Name: NF2363_high_12
Description: NF2363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2363_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 22 - 298
Target Start/End: Complemental strand, 43654009 - 43653733
Alignment:
| Q |
22 |
cacagatcgatcagcagaactaaactagcaatccattacacatggctgcaatgaactcaagtgtattagcttgtagctatgccatatctggttctgagct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43654009 |
cacagatcgatcagcagaactaaactagcaatccattacacatggctgcaatgaactcaagtgtattagcttgtagctatgccatatctggttctgagct |
43653910 |
T |
 |
| Q |
122 |
caatgcaaagctcatttcagtgccctctgctgcatcaccaggggtttcaggtatcaagctaccattgatcaaggctcagcaggtgagaattcctgaagcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653909 |
caatgcaaagctcatttcagtgccctctgctgcatcaccaggggtttcaggtatcaagctaccattgatcaaggctcagcaggtgagaattcctgaagcc |
43653810 |
T |
 |
| Q |
222 |
aaagaatcaagagcaagtgatggaagaagaaatgctcttgctttattggcagctacacttttcaccactgctgtttc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43653809 |
aaagaatcaagagcaagtgatggaagaagaaatgctcttgctttattggcagctacacttttcaccactgctgtttc |
43653733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University