View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2363_low_15 (Length: 296)
Name: NF2363_low_15
Description: NF2363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2363_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 18 - 285
Target Start/End: Original strand, 32819005 - 32819272
Alignment:
| Q |
18 |
tgtcctcggttgatccatttgtaatttcagatcatttccttgagttttgcaactcggcaggtatctctaaaaagcggcgagccttaatgcatttgatttg |
117 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32819005 |
tgtcctcgattgatccatttgtaatttcggatcatttccttgagttttgcaactcgccaggtatctctaaaaagcggcgagccttaatgcatttgattta |
32819104 |
T |
 |
| Q |
118 |
gtttgttgatgtttgaattatttgaaatgaaaggaatagcacgatttataaaaacaaggagcatgcatttactcagcttctagatacagttaaacttcct |
217 |
Q |
| |
|
||| |||||||||||||||||||| |||||||||||||||| ||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
32819105 |
gttcgttgatgtttgaattatttggaatgaaaggaatagcatgatttttaaaaataaggagcatgcatttactcagcttctagacacagttaaacttctt |
32819204 |
T |
 |
| Q |
218 |
tcttttttgtggcttgcaaaattttataattttgttataggttatcatagttgatgatttcccccttt |
285 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32819205 |
tcttttttgtggctagcaaaattttataattttgttataggttatcatagttggtgatttcccccttt |
32819272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University