View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2363_low_17 (Length: 278)
Name: NF2363_low_17
Description: NF2363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2363_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 30 - 263
Target Start/End: Original strand, 11613201 - 11613431
Alignment:
| Q |
30 |
aattatttaaatttactaccattttctacaagattaaattaccaacttggttcacaggatgaaatttcataaactgtatcatcaaccaacacatcttgct |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613201 |
aattatttaaatttactaccattttctacaagattaaattaccaacttggttcactggatgaaatttcataaactgtatcatcaaccaacacatcttgct |
11613300 |
T |
 |
| Q |
130 |
ccaagcattgagaaataacctagtttccttaaaaaggtttgtgtcttgagtattagcaatggaaaaaatagaagtgaaggggtacatatcccttatatag |
229 |
Q |
| |
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11613301 |
ccaagcattgaga---aaactagtttccttaaaaaggtttgtgtcttgagtattagcaatggaaaaaatagaagtgaaggggtacatatcccttatatag |
11613397 |
T |
 |
| Q |
230 |
gtttactcaaatcgactttacgcgcttatagtat |
263 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
11613398 |
gtttactcaaatcgactttccgcgcttatagtat |
11613431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University