View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2363_low_19 (Length: 252)
Name: NF2363_low_19
Description: NF2363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2363_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 24 - 247
Target Start/End: Original strand, 11612822 - 11613045
Alignment:
| Q |
24 |
acagaggaactaagatggctttatattactctttatattatcaagcataataaatagaaattaaacatctattacaattcttagaatttgggttgaatct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11612822 |
acagaggaactaagatggctttatattactctttatattatcaagcataataaatagaaattaaacatctattacaattcttagaatatgggttgaatct |
11612921 |
T |
 |
| Q |
124 |
agcttaaccctttcggaacagttctctattgttagggatacttcccgcttagaaagtcattttcagaacgtatctcatctaacgagactctcagcagatt |
223 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11612922 |
agcttaaccctttcgaaacagttctctatggttagggacacttcccgcttagaaagtcattttcagaacgtatctcatctaacgagactctcaacagatt |
11613021 |
T |
 |
| Q |
224 |
tccttttgcttaggaccgaacatt |
247 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11613022 |
tccttttgcttaggaccgaacatt |
11613045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University