View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2363_low_20 (Length: 249)
Name: NF2363_low_20
Description: NF2363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2363_low_20 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 2785917 - 2786153
Alignment:
| Q |
13 |
aacctgtgtagaagcagtaagatatcccgaactagtaattactgatggtccagaaaatgccgtgccacgctcaatttttacgccacgctcaacttttacc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2785917 |
aacctgtgtagaagcagtaagatatcccgaactagtaattactggcggtccagaagatgtcgtgccacgctcaatttttacgacacgctcaacttttacc |
2786016 |
T |
|
| Q |
113 |
ggcaatggctcaacttttacaggcactggctcaacttttacagtagcaggagtcacattcacattaggtattggctgccggttagcaatagatccattca |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786017 |
ggcaatggctcaacttttacaggcactggctcagcttttacagtagcaggagtcacactgacattaggtattggctgccggttagcaatagatccattca |
2786116 |
T |
|
| Q |
213 |
ccgatggcaatgaagatgggggtgcccccgtaactgg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2786117 |
ccgatggcaatgaagatgggggtgcccccgtaactgg |
2786153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 22519795 - 22519728
Alignment:
| Q |
146 |
acttttacagtagcaggagtcacattcacattaggtattggctgccggttagcaatagatccattcac |
213 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||| |||||||| | ||||||||||||||| |
|
|
| T |
22519795 |
acttttacagtagcaggagtcacattcccagcaggtattggttgccggttcggaatagatccattcac |
22519728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 215 - 249
Target Start/End: Complemental strand, 22518378 - 22518344
Alignment:
| Q |
215 |
gatggcaatgaagatgggggtgcccccgtaactgg |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22518378 |
gatggcaatgaagatgggggtgcccccgtaactgg |
22518344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 13 - 66
Target Start/End: Complemental strand, 22520342 - 22520289
Alignment:
| Q |
13 |
aacctgtgtagaagcagtaagatatcccgaactagtaattactgatggtccaga |
66 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||| |||||||| |||||||| |
|
|
| T |
22520342 |
aacctgtgcagaagcagtaagagatccagaactagttattactgacggtccaga |
22520289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University