View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2363_low_24 (Length: 203)
Name: NF2363_low_24
Description: NF2363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2363_low_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 30400026 - 30399852
Alignment:
| Q |
11 |
gtgagatgaagtgttatggttgaaatgggtgaaagaaaatgagaggatgaaactaaaaggttgcatttttatgttggtgatgatggaagtagatgagtga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30400026 |
gtgaaatgaagtgttatggttgaaatgggtgaaagaaaatgagaggatgaaactaaaaggttgcatttttatgttggtgatgatggaagtagatgagtga |
30399927 |
T |
|
| Q |
111 |
atgagacagagacagagacagagcaacttcagtagttgtcagagnnnnnnntgtgtgagaaagcagaggaacagt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30399926 |
atgagacagagacagagacagagcaacttcagtagttgtcagagaaaaaaatgtgtgagaaagcagaggaacagt |
30399852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University