View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2363_low_7 (Length: 394)
Name: NF2363_low_7
Description: NF2363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2363_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 20 - 385
Target Start/End: Complemental strand, 1180162 - 1179797
Alignment:
| Q |
20 |
gctaacgccgtcacggtggtgaattcaatccccaacagagaattcgattcaatgctcaacactctccgatcacgcggttaccacctcttctgcaatgcaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1180162 |
gctaacgccgtcacggtggtgaattcaatccccaacagagaattcgattcaatgctcaacactctccgatcacgcggttaccacctcttctgcaatgcaa |
1180063 |
T |
 |
| Q |
120 |
tcctcacctctgatcttcgaatcgatcttcttgatccaaattcaaacgccacaaactctttcactttcttcgctcccactgattcttcactcttcgctct |
219 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1180062 |
tcctcacctccgatcttcgaatcgatcttcttgatccaaattcaaacgccacaaactctttcactttcttcgctcccactgattcttcactcttcgctct |
1179963 |
T |
 |
| Q |
220 |
cgacatgacgcaaactgcgtcgtcttacaccgatactctccgttatcatatcattccacgccgtctcactctttctgagcttcgtcttcttcctaacggt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179962 |
cgacatgacgcaaactgcgtcgtcttacaccgatactctccgttatcatatcattccacgccgtctcactctttctgagcttcgtcttcttcctaacggt |
1179863 |
T |
 |
| Q |
320 |
tacacgctccctacgatgttatccacgcgccgtatttcgttcacgcgccgatctggttcttcttct |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1179862 |
tacacgctccctacgatgttatccacgcgccgtatttcgttcacgcgccgatctggttcttcttct |
1179797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University