View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2364_low_7 (Length: 328)
Name: NF2364_low_7
Description: NF2364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2364_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 14 - 308
Target Start/End: Original strand, 42899010 - 42899304
Alignment:
| Q |
14 |
tcatcacaacatgaacaatctccaaacacaagatatccaaggcttcacattgaagaaagagcatcaaagtttcaacatgttaaggccagaacaagaagta |
113 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42899010 |
tcatcacaacatgaacaatctccaaactcaagatatccaaggcttcacattgaagaaagagcatcaaagtttcaacatgttaaggccagaacaagaagta |
42899109 |
T |
|
| Q |
114 |
caaataccctcttggctttgtcaatcatccattgatctctcttcaaactattcaagtttggatcaagatctacacctttatgaaaaccctaaccctagaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42899110 |
caaataccctcttggctttgtcaatcatccattgatctctcttcaaactattcaagtttggatcaagatctacacctttatgaaaaccctaaccctagaa |
42899209 |
T |
|
| Q |
214 |
atggtcctactcctacacttccatcctaccaaccatcatctgcagcttcacctcacatgtcagctacagcattgttacagaaagcagctcagatg |
308 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42899210 |
atggtcctacttctacacttccatcctaccaaccatcatctgcagcttcacctcacatgtcagctacagcattgttacagaaagcagctcagatg |
42899304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 304
Target Start/End: Complemental strand, 5787666 - 5787629
Alignment:
| Q |
267 |
cacatgtcagctacagcattgttacagaaagcagctca |
304 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
5787666 |
cacatgtcagctactgcattgttgcagaaagcagctca |
5787629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University