View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2365_high_9 (Length: 375)
Name: NF2365_high_9
Description: NF2365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2365_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 56 - 359
Target Start/End: Original strand, 34883324 - 34883632
Alignment:
| Q |
56 |
ctactgttaccttgttttactacctacaaaatctagtctagtctatctaggaacatagtaatacttgtcaccgttggattttccttagacaaggatcatt |
155 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34883324 |
ctactgttaccttgttttgctacctacaaaatctagtctagtctatctaggaacatagtaatact-gtcaccgttggattttccttagacaaggatcatt |
34883422 |
T |
 |
| Q |
156 |
catgactgagtttgtgatttacatgcatattacgtggcttcttatcctctttccatctcattgttgttta------acttccatacatatattgctattt |
249 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
34883423 |
catgagtgagtttgtgatttacatgcatattacgtggcttcttatcctctttccatctcattgttgtttaatttccaattccatacatatattgctattt |
34883522 |
T |
 |
| Q |
250 |
tcacccctcacttttcctaatcattaatagagtaacacaaatagcatccgttttaacgtattctttctaaaatttactttttcattagataaaatatata |
349 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
34883523 |
tcacccctcacttttcctaatcattaatagagtaacacaaatagcatccattttaacgtattctttctcaaatttactttttcattagataaaacatata |
34883622 |
T |
 |
| Q |
350 |
tgggtcttac |
359 |
Q |
| |
|
|||||||||| |
|
|
| T |
34883623 |
tgggtcttac |
34883632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University