View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2365_low_12 (Length: 290)
Name: NF2365_low_12
Description: NF2365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2365_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 288
Target Start/End: Complemental strand, 5697059 - 5696789
Alignment:
| Q |
18 |
ctttgaacttcaaaacttttgttcagtcttccaccttgtcctctcatgcacaaaactatcttccccttgaccttgcttggatcaagggtattgtcttggc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697059 |
ctttgaacttcaaaacttttgttcagtcttccaccttgtcctctcatgcacaaaactatcttccccttgaccttgcttggatcaagggtattgtcttggc |
5696960 |
T |
|
| Q |
118 |
aataactgcatcatgaaatatatgtaaatatattaaccnnnnnnnnnnnnngaacaataaatatattaaccttttaattagtccaataatctaaatttaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5696959 |
aataactgcatcatgaaatatatgtaaatatattaacctttttttttttttgaacaataaatatattaaccttttaattagtccaataatctaaatttaa |
5696860 |
T |
|
| Q |
218 |
gagaggtgtaaaaccagacatagaaaatacccagaatttgtttttagtatgccagcatattcttcgacatc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
5696859 |
gagaggtgtaaaaccagacatagaaaatacccagaatttgtttttagtatgcctgcatattcttcaacatc |
5696789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 5684889 - 5684771
Alignment:
| Q |
18 |
ctttgaacttcaaaacttttgttcagtcttccaccttgtcctctcatgcacaaaactatcttccccttgaccttgcttggatcaagggtattgtcttggc |
117 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
5684889 |
ctttgaacttccaaactttttttcactcttccaccttgccctctcatgcacaaaactatttttcccttgaccttgcttggatcaagggtattgtctaggc |
5684790 |
T |
|
| Q |
118 |
aataactgcatcatgaaat |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5684789 |
aataactgcatcatgaaat |
5684771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University