View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2365_low_21 (Length: 234)
Name: NF2365_low_21
Description: NF2365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2365_low_21 |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 13 - 131
Target Start/End: Original strand, 12654114 - 12654232
Alignment:
| Q |
13 |
aattaacacatcaaacaatatatgaatttcattacaaggcccaagagataagataagaaaccacaatacctatttatgccaagttcaaatgtctggttag |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12654114 |
aattaacacatcaaacaatatatgaatttcattacaaggtccaagatataagataagaaaccacagtacctatttatgccaagttcaaatgtctggttag |
12654213 |
T |
 |
| Q |
113 |
cagctttaaacttgttctt |
131 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12654214 |
cagctttaaacttgttctt |
12654232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 142 - 226
Target Start/End: Original strand, 46832931 - 46833015
Alignment:
| Q |
142 |
ccccttataatttaaagatgaattggtttacatcctcaagatagctgattgtgcaaagtgtatgatgtggcacgttgatgtgtta |
226 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||||||| ||||||| ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46832931 |
ccccttataatttaaaaattaattggtttacaccctcaaggtagctgactgtgcaaagtgtatgatgtggcacgctgatgtgtta |
46833015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 132 - 226
Target Start/End: Original strand, 20673630 - 20673724
Alignment:
| Q |
132 |
ttggagattcccccttataatttaaagatgaattggtttacatcctcaagatagctgattgtgcaaagtgtatgatgtggcacgttgatgtgtta |
226 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||| |||||| ||||||| ||||||| ||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
20673630 |
ttggagattcccccctgtaatttaaagattctttgctttacaccctcaaggtagctgactgttcaaagtgtatgatgtggcacgctgatgtgtta |
20673724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 132 - 226
Target Start/End: Original strand, 454 - 549
Alignment:
| Q |
132 |
ttggagattcccccttataatttaaagatgaattggtttacatcc-tcaagatagctgattgtgcaaagtgtatgatgtggcacgttgatgtgtta |
226 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||| | || ||| ||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
454 |
ttggagattcccccttcaaattaaaagattctttggtttatacccctcacgatagctgactgtgcaaaatgtatgatgtggcacgttgatgtgtta |
549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 140 - 222
Target Start/End: Original strand, 42277304 - 42277387
Alignment:
| Q |
140 |
tcccccttataatttaaagatgaattggtttacatcc-tcaagatagctgattgtgcaaagtgtatgatgtggcacgttgatgt |
222 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| || ||||| ||||||| |||||| |||||||||||||||||| |||||| |
|
|
| T |
42277304 |
tcccccttgtaatttaaagattctttggtttacacccctcaaggtagctgactgtgcatagtgtatgatgtggcacgctgatgt |
42277387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University