View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2365_low_22 (Length: 232)
Name: NF2365_low_22
Description: NF2365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2365_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 11 - 215
Target Start/End: Original strand, 36726686 - 36726893
Alignment:
| Q |
11 |
ataatactgatacatatttttggcttgatcctttgttggaagaggggaggttgtgtgattggtggta----gaaaaatatgttagggtgacaaatatgct |
106 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36726686 |
ataataatgatacatatttttggcttgatcctttgttggaagaggagagattgtgtaattggtggtacgtagaaaaatatgttagggtgacaaatatgct |
36726785 |
T |
 |
| Q |
107 |
ttgcttgagtgagaatgttggagattcccaaaggaaaatcaaaccacctaggatggaagaaatgttaaggtcatcaaggcgcatgaatgaatctaaagag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36726786 |
ttgcttgagtgagaatgttggagattcccaaaggaaaa-caaaccacctaggatggaagaaatgttaaggtcatcaaggcgcatgaatgaatctaaagag |
36726884 |
T |
 |
| Q |
207 |
aagaagacg |
215 |
Q |
| |
|
||||||||| |
|
|
| T |
36726885 |
aagaagacg |
36726893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University