View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2365_low_26 (Length: 201)
Name: NF2365_low_26
Description: NF2365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2365_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 51156490 - 51156325
Alignment:
| Q |
18 |
caactaatgtgacctaatacctctnnnnnnnntctaatttcacctaataattttttcttttgcttcctcgtttgtcccgtggaatgtgtgatattaagtt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51156490 |
caactaatgtgacctaatacctctaaaaaaaatctaatttcacctaataattttttcttttgcttcctcgtttgtcccgtggaatgtgtgatattaagtt |
51156391 |
T |
|
| Q |
118 |
gatctttttagctttcttgttttggaagaaagttgatgggactttcttctctctgccggcctgttt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51156390 |
gatctttttagctttcttgttttggaagaaagttgatgggactttcttctctctgccggcctgttt |
51156325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University