View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2366_high_2 (Length: 353)
Name: NF2366_high_2
Description: NF2366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2366_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 1 - 335
Target Start/End: Original strand, 42340857 - 42341191
Alignment:
| Q |
1 |
caaggggaggtagaatcattgcagagggaaggagaagaagcgaccaggaatgacgtcaacaatgtcatttcttcatcgctcggaaggcaatcgtcatcca |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
42340857 |
caaggggaggtagaatcattgcaaagggaaggagaagaagcgatcaggaatgacgtcaacaatgtcatttcttcatcgctcggaaggcaatcttcatcca |
42340956 |
T |
 |
| Q |
101 |
tatactcactcacccttgacgagttccaacacagcctctgtgatagcggcaagaatttcggatccatgaacatggatgagtttctaagtagtatttggaa |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340957 |
tatactcactcaccctcgacgagttccaacacagcctctgtgatagcggcaagaatttcggatccatgaacatggatgagtttctaagtagtatttggaa |
42341056 |
T |
 |
| Q |
201 |
tgcagaagaaaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctgcagctcagaaagggattagcaaacaggcaagtctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341057 |
tgcagaagaaaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctgcagctcagaaagggattagcaaacaggcaagtctt |
42341156 |
T |
 |
| Q |
301 |
cctcgccaaaattcgttatcgattcctgctcctct |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341157 |
cctcgccaaaattcgttatcgattcctgctcctct |
42341191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University