View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2369_high_6 (Length: 410)
Name: NF2369_high_6
Description: NF2369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2369_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 189 - 392
Target Start/End: Complemental strand, 3840654 - 3840451
Alignment:
| Q |
189 |
aaggttcaagatgcagaatattttgaagaagatgaaggacctgaagccctaggagaagaagtaggaaaaagaggaagcaaacgaggttcagagtctctag |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840654 |
aaggttcaagatgcagaatattttgaagaagatgaaggacctgaagccctaggagaagaagtaggaaaaagaggaagcaaacgaggttcagagtctctag |
3840555 |
T |
|
| Q |
289 |
aagttgaagcagctctaggagaaggatgcagaaagaaacccttttctcttatagctttatcttcagctaaagaatccaaagaagaaacatttctagcagc |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3840554 |
aagttgaagcagctctaggagaaggatgcagaaagaaacccttttctcttatagctttatcttcagctaaagaatccaaagaagaaccatttctagcagc |
3840455 |
T |
|
| Q |
389 |
agaa |
392 |
Q |
| |
|
|||| |
|
|
| T |
3840454 |
agaa |
3840451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 3840840 - 3840717
Alignment:
| Q |
1 |
taaacaaaaatagttcaattcgatggtaaaataattcttgatccgactcgacaaaagattattgaattgtcttccataaaataaaacactaatacaaatc |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3840840 |
taaacaaaaatagttcaatttgaaggtaaaataattcttgatccgactcgacaaaagattattgaattgtcttccataaaataaaacactaatacaaatc |
3840741 |
T |
|
| Q |
101 |
aatccatttcattagcaacaatgg |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
3840740 |
aatccatttcattagcaacaatgg |
3840717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University