View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2369_low_17 (Length: 237)
Name: NF2369_low_17
Description: NF2369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2369_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 2487679 - 2487469
Alignment:
| Q |
1 |
gatccttttcaaaagtgctgctgctccagaagcctgatgatccatcatctttagtcacggtttggccttgaattatttctcccttacatccctcatccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487679 |
gatccttttcaaaagtgctgctgctccagaagcctgatgatccatcatctttagtcacggtttggccttgaattatttctcccttacatccctcatccat |
2487580 |
T |
 |
| Q |
101 |
tgaaacagtagctcgaggtttttcgcggcttctaagacaacctatgctctatcnnnnnnnncatgttcaacaaaaagtgtgactaagaatcatacaatca |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2487579 |
tgaaacagtagcttgaggtttttcgcggcttctaagacaacctatgctctatc--aaaaaacatgttcaacaaaaagtgtgactaagaatcatacaatca |
2487482 |
T |
 |
| Q |
201 |
tgttacaatcacg |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2487481 |
tgttacaatcacg |
2487469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University