View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2369_low_18 (Length: 236)

Name: NF2369_low_18
Description: NF2369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2369_low_18
NF2369_low_18
[»] chr2 (1 HSPs)
chr2 (1-34)||(5394634-5394667)


Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 5394634 - 5394667
Alignment:
1 cagataaatgatatctcacaccctaaaactatct 34  Q
    ||||||||||||||||||||||||||||||||||    
5394634 cagataaatgatatctcacaccctaaaactatct 5394667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University