View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2369_low_7 (Length: 373)
Name: NF2369_low_7
Description: NF2369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2369_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 35 - 310
Target Start/End: Original strand, 15756676 - 15756953
Alignment:
| Q |
35 |
acttttttgatgatttgg-cacattttttacgatgtggcttacatatattggttaagtaacattttactcatttttacaattnnnnnnnttgcattatat |
133 |
Q |
| |
|
||||| |||||||||||| ||||||||| | |||||||| ||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
15756676 |
actttcttgatgatttgggcacatttttgatgatgtggcgtacatatattggttaagtaacatttgactcatttttacaat-aaaaaaattgcattatat |
15756774 |
T |
 |
| Q |
134 |
caaaatataattgtttaannnnnnnctcatattttgtagacataaaatattttaattaaaacatcaaaccctaaaatgtatgccctt-tttaatcttcat |
232 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||| |
|
|
| T |
15756775 |
caaaatataattgtttaacttttt-ctcatattttatagacataaaatattttaattaaaacatcaaaccctaaaaagtattcccttctttaatcttcat |
15756873 |
T |
 |
| Q |
233 |
cttcgacaccaaattcctaatttgccaacaatttatcactc--aaaaattcatcaaactcatattttcattaattcgtct |
310 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||| ||||||| ||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
15756874 |
cttcaacaccaaatttctaatttgccaacaattcatcactcataaaaattaatcaaactcatatttacattaatttgtct |
15756953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 18 - 98
Target Start/End: Original strand, 15756544 - 15756624
Alignment:
| Q |
18 |
aaaataccatggaagctacttttttgatgatttggcacattttttacgatgtggcttacatatattggttaagtaacattt |
98 |
Q |
| |
|
|||||||||| | || ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15756544 |
aaaataccattggagttacttttttgatgatttggcacattttttacgatgtggcgtacatatattggttaagtaacattt |
15756624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University