View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2370_high_5 (Length: 241)
Name: NF2370_high_5
Description: NF2370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2370_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 32267752 - 32267651
Alignment:
| Q |
1 |
aacaaataatgttgaactctgaattttcaggagtgttttggatcgtcctcactcccccgtcatgtatacttcttaccattgtcacgcgagagccatgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32267752 |
aacaaataatgttgaactctgaattttcaggagtgttttggatcgtcctcactcccccgtcatgtatacttcttaccattgtcacgcgagagccatgctt |
32267653 |
T |
 |
| Q |
101 |
at |
102 |
Q |
| |
|
|| |
|
|
| T |
32267652 |
at |
32267651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 32267785 - 32267749
Alignment:
| Q |
205 |
tcatgctatgcactttgttatcattgtgcatgcaaca |
241 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32267785 |
tcatgctatgcacgttgttatcattgtgcatgcaaca |
32267749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University