View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2370_low_11 (Length: 241)

Name: NF2370_low_11
Description: NF2370
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2370_low_11
NF2370_low_11
[»] chr3 (2 HSPs)
chr3 (1-102)||(32267651-32267752)
chr3 (205-241)||(32267749-32267785)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 32267752 - 32267651
Alignment:
1 aacaaataatgttgaactctgaattttcaggagtgttttggatcgtcctcactcccccgtcatgtatacttcttaccattgtcacgcgagagccatgctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32267752 aacaaataatgttgaactctgaattttcaggagtgttttggatcgtcctcactcccccgtcatgtatacttcttaccattgtcacgcgagagccatgctt 32267653  T
101 at 102  Q
    ||    
32267652 at 32267651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 205 - 241
Target Start/End: Complemental strand, 32267785 - 32267749
Alignment:
205 tcatgctatgcactttgttatcattgtgcatgcaaca 241  Q
    ||||||||||||| |||||||||||||||||||||||    
32267785 tcatgctatgcacgttgttatcattgtgcatgcaaca 32267749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University