View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_high_48 (Length: 306)
Name: NF2371_high_48
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 15 - 205
Target Start/End: Complemental strand, 27119404 - 27119214
Alignment:
| Q |
15 |
ggagtcaaatttcaaaacatcaacacctccatattctccatacacccaagccttcatttcagaaggaacttgtgtcactttcacagcctcagatgaagca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119404 |
ggagtcaaatttcaaaacatcaacacctccatattctccatacacccaagccttcatttcagaaggaacttgtgtcactttcacagcctcagatgaagca |
27119305 |
T |
 |
| Q |
115 |
gtagtagattgagacttcaccaagaatctagcatgccttgttgaagaagacaagagagttttgagacaagttttttggttagtttttggtt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27119304 |
gtagtagattgagacttcaccaagaatctagcatgccttgttgaagaagacaagagagttttgagacaagttttttggttagtttttggtt |
27119214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University