View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_high_66 (Length: 260)
Name: NF2371_high_66
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_high_66 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 101 - 246
Target Start/End: Complemental strand, 8796742 - 8796599
Alignment:
| Q |
101 |
gattatatttacttcgaatatttagaccattgttgcgaaatttaattcaaaaatatattttgagtaaaaacttgttttggccccttgcaatttttcaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
8796742 |
gattatatttacttcgaatatttagaccattgttgcgatatttaattcaaaaatatattttgagtaaaaacttgttttggttccttgcaattttccaagg |
8796643 |
T |
|
| Q |
201 |
gatatcaattagtctttgnnnnnnntaggttaaatattttaccttc |
246 |
Q |
| |
|
| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8796642 |
g--atcaattagtctttgaaaaaaataggttaaatattttaccttc |
8796599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 1 - 68
Target Start/End: Complemental strand, 8796801 - 8796734
Alignment:
| Q |
1 |
tagcacgtattcggtggggtctcattggtttattattttatttaagcaatatttcattggattatatt |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8796801 |
tagcacgtattcggtggggtctcattggtttattattttatttaagcaaaatttcattggattatatt |
8796734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University