View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_high_68 (Length: 254)
Name: NF2371_high_68
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_high_68 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 254
Target Start/End: Complemental strand, 2645539 - 2645300
Alignment:
| Q |
15 |
caaaggcgcgaatcgtgtcaaagatgcggcgattcaaagtatggagagagagttgattatggatcagtttttggaggaattagaggaggatcttcatttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2645539 |
caaaggcgcgaatcgtgtcaaagatgcggcgattcaaagtatggagagagagttgattatggatcagtttttggaggaattagaggaggatcttcatttg |
2645440 |
T |
|
| Q |
115 |
gtttaagtggttcagatgttcgtttaggtgattggtattgtggtgctggtaattgtggtgcacacaactttgccagtcgtttaagttgcttcaaatgtgg |
214 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2645439 |
gtttaagtggttcggatgttcgtttaggtgattggtattgtggtgctggtaattgtggtgcacacaactttgccagtcgtttaagttgcttcaaatgtgg |
2645340 |
T |
|
| Q |
215 |
tgctttcaaagatgacctagctggaggaggatataataat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2645339 |
tgctttcaaagatgacctagctggaggaggatataataat |
2645300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University