View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_high_80 (Length: 240)
Name: NF2371_high_80
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_high_80 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 44534233 - 44534009
Alignment:
| Q |
1 |
aaaaattctcttcaaaatctaaaaatttctacaggtacaacacgatac-gcagatgtagaggatttaggtcaatctttgtgtcttttgtttacatccaat |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44534233 |
aaaaattctcttcaaaatctaaaaatttctataggtacaacacgatactgcagatgcagaggatctaggtcaatctttgtgtctgttgtttacatccaat |
44534134 |
T |
 |
| Q |
100 |
gagaagcttccttatcttgtctcatacaactgtgtccattgatgaaagtttatttgttgtcacaacttcataacggctactaacacctccttcatcttct |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44534133 |
gagacgcttccttatcttgtctcatacaattgtgtccattgatgaaagtttatttgttgtcacaacttcataacggctactaacacctccttcatcttct |
44534034 |
T |
 |
| Q |
200 |
tccatgctatctccatcttcatatt |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44534033 |
tccatgctatctccatcttcatatt |
44534009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University