View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_high_83 (Length: 238)
Name: NF2371_high_83
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_high_83 |
 | |
|
| [»] scaffold0161 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 2645282 - 2645060
Alignment:
| Q |
1 |
aagaggttttggtggaagtacaagacctggatggaaatctggtgattggatatgcaacaggtaattatattgtaatagtttgtatagtttttgcattatt |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2645282 |
aagaggtttcggtggaagtacaagacctggatggaaatctggtgattggatatgcaacaggtaattatattgtaatattttgtatagtttttgcattatt |
2645183 |
T |
|
| Q |
101 |
gatatttcttatattgtctagagttcgaaccctcacccctgcatataacagtccatatttctgtcaattgagttatgctcaaaggaactcttgtggtcaa |
200 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
2645182 |
gatatttcttgtattatctagagttcgaaccctcacccctgcatataacagtctatatttctgtcaattgagttatgttcaaagggactcttgtggtcaa |
2645083 |
T |
|
| Q |
201 |
attttaataagtaatattataaa |
223 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
2645082 |
attttagtaagtaatattataaa |
2645060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 181
Target Start/End: Original strand, 6128648 - 6128705
Alignment:
| Q |
123 |
gttcgaaccctcacccctgcatataacagtccatatttctgtcaattgagttatgctca |
181 |
Q |
| |
|
|||||||||| |||| |||||||||||| | ||||||| |||||| ||||||||||||| |
|
|
| T |
6128648 |
gttcgaaccc-caccactgcatataacaatgcatatttttgtcaactgagttatgctca |
6128705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 181
Target Start/End: Original strand, 24160564 - 24160622
Alignment:
| Q |
123 |
gttcgaaccctcacccctgcatataacagtccatatttctgtcaattgagttatgctca |
181 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| | |||| ||| ||||||||||||| |
|
|
| T |
24160564 |
gttcgaaccccgacccctgcatataacagtgcatgtctctgccaactgagttatgctca |
24160622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0161 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0161
Description:
Target: scaffold0161; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 137 - 181
Target Start/End: Original strand, 26225 - 26269
Alignment:
| Q |
137 |
ccctgcatataacagtccatatttctgtcaattgagttatgctca |
181 |
Q |
| |
|
||||| |||||||| | ||| |||||||||||||||||||||||| |
|
|
| T |
26225 |
ccctgaatataacaattcatgtttctgtcaattgagttatgctca |
26269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 4605891 - 4605943
Alignment:
| Q |
136 |
cccctgcatataacagtccatatttctgtcaattgagttatgctcaaaggaac |
188 |
Q |
| |
|
||||||||||||||| | ||| | |||||||| ||||||||||||||| |||| |
|
|
| T |
4605891 |
cccctgcatataacaatgcatgtctctgtcaactgagttatgctcaaatgaac |
4605943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University