View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_high_84 (Length: 238)
Name: NF2371_high_84
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_high_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 12311884 - 12311690
Alignment:
| Q |
17 |
acaaagtctcccagaccccttcatcttttgaagcgaatcatctagttttgttattagatcttcctacttagcagcgtgttcatcaaactgtaagatctta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||| |
|
|
| T |
12311884 |
acaaagtctcccagaccccttcatcttttgaagcgattcatgtagttttgttattagatcttcctacttagcagcatgctcatcaaactgtaagatatta |
12311785 |
T |
 |
| Q |
117 |
ttcttctcaacatgtaagttatgaacattagtataagcatctgtacaaaagtcatcaagtttggggtgagttaaggctggtggttcacatatgtt |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12311784 |
ttcttctcaacaggtaagttatgaacattagtataagcatctgtacaaaagtcatcaagtttggggtgagttaagggtggtggttcacatatgtt |
12311690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University