View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_105 (Length: 211)
Name: NF2371_low_105
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_105 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 192
Target Start/End: Original strand, 35417695 - 35417873
Alignment:
| Q |
14 |
atgaaggaaaaaacaagagaataagaggaaggtatgagtttgttggcaaatagttttagcaacaaaaataaacaaatatgggatttgtaggaaggaggag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417695 |
atgaaggaaaaaacaagagaataagaggaaggtatgagtttgttggcaaatagttttagcaacaaaaataaacaaatatgggatttgtaggaaggaggag |
35417794 |
T |
|
| Q |
114 |
taagttataattttgttagagggctttgtttgtgttgggattttgtttttctcccaaacccaattattgaagggaatgg |
192 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35417795 |
taagttataattttgttagagggttttgtttgtgttgggattttgtttttctcccaaacccaattattgaagggaatgg |
35417873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University