View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_109 (Length: 203)
Name: NF2371_low_109
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_109 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 13902326 - 13902495
Alignment:
| Q |
18 |
tgcaaccatctacagcataccctccaatatttgctgcatgattcttttgacactcaccatatctaatatttcttgtaattgaagatgatgttttagccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13902326 |
tgcaaccatctacagcataccctccaatatttgctgcatgattcttttgacactcaccatatctaatatttcttgtaattgaagatgatgttttagccac |
13902425 |
T |
 |
| Q |
118 |
aacttgtctcttcttcatcctttcaaaatccctatacttgaagattatagtgatggttctaggtagctat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13902426 |
aacttgtctcttcttcatcctttcaaaatccctatacttgaagattatagtgatggttctaggtagctat |
13902495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 79
Target Start/End: Complemental strand, 3643212 - 3643153
Alignment:
| Q |
20 |
caaccatctacagcataccctccaatatttgctgcatgattcttttgacactcaccatat |
79 |
Q |
| |
|
|||||||| |||||||| ||||||| ||| |||||||||||||| |||||||| |||||| |
|
|
| T |
3643212 |
caaccatcaacagcataacctccaacattagctgcatgattcttctgacactctccatat |
3643153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0140 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 23 - 80
Target Start/End: Complemental strand, 32847 - 32790
Alignment:
| Q |
23 |
ccatctacagcataccctccaatatttgctgcatgattcttttgacactcaccatatc |
80 |
Q |
| |
|
||||| |||||||| |||||| ||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
32847 |
ccatcaacagcatagcctccactataagctgcatgattcttttgacactctccatatc |
32790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University