View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_17 (Length: 442)
Name: NF2371_low_17
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 412; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 412; E-Value: 0
Query Start/End: Original strand, 7 - 426
Target Start/End: Complemental strand, 21911720 - 21911301
Alignment:
| Q |
7 |
gaaatgtatttataaaagttaactggctccgattaacttgaacttgaaggacttcaccaatgggcagaaggaaaatgcttgccttaattagtaaccatct |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21911720 |
gaaatgaatttataaaagttaactggctccgattaacttgaacttgaaggacttcaccaatgggcagaaggaaaatgcttgccttaattagtaaccatct |
21911621 |
T |
 |
| Q |
107 |
tgtggatttggcaacccactatgcattaaaatcatttttgaattttatcagagtcaattatctttatacataatttcagagtaaaaatttgaaagtcatt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21911620 |
tgtggatttggcaacccactatgcattaaaatcatttttgaattttatcagagtcaattatctttatacataatttcagagtaaaaatttgaaagtcatt |
21911521 |
T |
 |
| Q |
207 |
gattttatataaacctacaatcatttgtttttagcaagcaaaatttatcaatattggatcatttatgtatctagctatctaacctataaaatgttaaaat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21911520 |
gattttatataaacctacaatcatttgtttttaacaagcaaaatttatcaatattggatcatttatgtatctagctatctaacctataaaatgttaaaat |
21911421 |
T |
 |
| Q |
307 |
aagactgcgcacaaacttcagtcatctcatctcagataattatttattgccacatgaacaaattggctgttgtattaatctcattcaatttcagcattta |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21911420 |
aagactgcgcacaaacttcagtcatctcatctcagataattatttattgccacatgaacaaattggctgttgtattaatctcattcaatttcagcattta |
21911321 |
T |
 |
| Q |
407 |
ctaatatttgggggattcct |
426 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21911320 |
ctaatatttgggggattcct |
21911301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University