View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2371_low_27 (Length: 408)
Name: NF2371_low_27
Description: NF2371
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2371_low_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 11 - 389
Target Start/End: Original strand, 37989293 - 37989671
Alignment:
| Q |
11 |
cacagaacacagtaagtgcttcacaaatgatggcattggctgaagggttagaagaaagtgagaaacttttcatttgggttattagaccaccttgtggttt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37989293 |
cacagaacacagtaagtgcttcacaaatgatggcattggctgaagggttagaagaaagtgagaaacttttcatttgggttattagaccaccttgtggttt |
37989392 |
T |
|
| Q |
111 |
tgacattaatgcagagttcaaagcagaatggttgccagaaggatttgaagagagaatgaagcatagtaaaaggggtttgttggtgcataaatggggacct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37989393 |
tgacattaatgcagagttcaaagcagaatggttgccagaaggatttgaagagagaatgaagcatagtaaaaggggtttgttggtgcataaatggggacct |
37989492 |
T |
|
| Q |
211 |
cagttagagattctatcacacaaatcaacaggagcatttctaagtcattgtgggtggaattctgttttggagagtcttagccaaggggtgccaattattg |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37989493 |
cagttagagattctatcacacaaatcaacaggagcatttctaagtcattgtgggtggaattctgtattggagagtcttagccaaggggtgccaattattg |
37989592 |
T |
|
| Q |
311 |
gttggccacttgcagcagaacaagcatacaatgcaaagatgttggtagaagaaatgggggtgagtgtggaactgacaag |
389 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37989593 |
gttggccacttgcagcagaacaagcatacaatgcaaagatgttggtagaagaaatgggggtgagtgtggaactgacaag |
37989671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University